Top » Catalog » SNPs » A10023

$18.00

A10023
[A10023]

A10023
HG19 Position: ChrY:7644895..7644895
Ancestral: T
Derived: G
Reference: Randy Zielaskowski (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below Z326 > A5011
Forward Primer: A10023vl_F GAAGTGAGCACTTTAGTACTTTCTAATTAGTG
Reverse Primer: A10023vl_R GATAACTTTTATTGGTGACAGGAAGAG
Reviews

Customers who bought this product also purchased
A100
A100
A1
A1
A10022
A10022
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies