Top » Catalog » SNPs » A10025

$18.00

A10025
[A10025]

A10025
HG19 Position: ChrY:15187259..15187259
Ancestral: T
Derived: A
Reference: Connie McKenzie (2016)
ISOGG Haplogroup: I2
Comments: Downstream of Y4750 > Y11858 > Y15017
Forward Primer: A10025_F GAGCTGATGTTTTGGAATTAGATAGAC
Reverse Primer: A10025_R GGAGAGCAGGAGTTCTTTCTGTAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10730
$18.00
Haplogroup Info
Other products
Currencies