Top » Catalog » SNPs » A10026

$18.00

A10026
[A10026]

A10026
HG19 Position: ChrY:6851906..6851906
Ancestral: G
Derived: T
Reference: Connie McKenzie (2016)
ISOGG Haplogroup: I2
Comments: Downstream of Y4750 > Y11858 > Y15017
Forward Primer: A10026_F TCGTTTTCCCTCCAGAGTTG
Reverse Primer: A10026_R GAGGATGCTGAGAACTTGTAACG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies