Top » Catalog » SNPs » A10028

$17.50

A10028
[A10028]

A10028
HG19 Position: ChrY:2720236..2720236
Ancestral: A
Derived: G
Reference: Zdenko Markovich (2016)
ISOGG Haplogroup: I2
Comments: Downstream L1498
Forward Primer: A10028_F CTCTCCTTCTGCCACCATTC
Reverse Primer: A10028_R ATGCTGCATGCAAACATACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies