Top » Catalog » SNPs » A10029

$18.00

A10029
[A10029]

A10029
HG19 Position: ChrY:13769415..13769415
Ancestral: C
Derived: T
Reference: Zdenko Markovich (2016)
ISOGG Haplogroup: I2
Comments: Downstream L1498
Forward Primer: A10029_F AAAAGTCAGTGTGGCCAGGTAG
Reverse Primer: A10029_R CTCACCTTAGGAAAGGTAGTACCTAATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10872
1 x A11145
1 x A10009
$54.00
Haplogroup Info
Other products
Currencies