Top » Catalog » SNPs » A10030

$18.00

A10030
[A10030]

A10030
HG19 Position: ChrY:19504620..19504620
Ancestral: C
Derived: T
Reference: Zdenko Markovich (2016)
ISOGG Haplogroup: I2
Comments: Downstream L1498
Forward Primer: A10030_F AGAGGGAATCGGGAATTCTG
Reverse Primer: A10030_R TGATGCCCAGCTGATACTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1028
1 x A10218
1 x A10137
1 x A10600
1 x A10233
1 x A11296
$108.00
Haplogroup Info
Other products
Currencies