Top » Catalog » SNPs » A10032

$18.00

A10032
[A10032]

A10032
HG19 Position: ChrY:19742502..19742502
Ancestral: T
Derived: C
Reference: Zdenko Markovich (2016)
ISOGG Haplogroup: I2
Comments: Downstream L1498
Forward Primer: A10032_F AAGAGCTGGACACAAAACCAG
Reverse Primer: A10032_R ATGGAGTTTCACCGATTTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies