Top » Catalog » SNPs » A10034

$18.00

A10034
[A10034]

A10034
hg38 Position: ChrY:14401388..14401388
Ancestral: T
Derived: C
Reference: Zdenko Markovich (2016)
ISOGG Haplogroup: I2a1a2a1a (not listed)
Comments: Downstream L233 > Y4252 > A10033
Forward Primer: A10034_F CCATTTTATATGTAAACCCAAGCAC
Reverse Primer: A10034_R TCAGGCACAAATAGTTTACATGC
Reviews

Customers who bought this product also purchased
Y4252
Y4252
A7111
A7111
L1287
L1287
A15050
A15050
M26
M26
A15076
A15076
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies