Top » Catalog » SNPs » A10034

$17.50

A10034
[A10034]

A10034
HG19 Position: ChrY:16513268..16513268
Ancestral: T
Derived: C
Reference: Zdenko Markovich (2016)
ISOGG Haplogroup: I2
Comments: Downstream L233
Forward Primer: A10034_F CCATTTTATATGTAAACCCAAGCAC
Reverse Primer: A10034_R TCAGGCACAAATAGTTTACATGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies