Top » Catalog » SNPs » A10034

$18.00

A10034
[A10034]

A10034
HG19 Position: ChrY:16513268..16513268
Ancestral: T
Derived: C
Reference: Zdenko Markovich (2016)
ISOGG Haplogroup: I2
Comments: Downstream L233
Forward Primer: A10034_F CCATTTTATATGTAAACCCAAGCAC
Reverse Primer: A10034_R TCAGGCACAAATAGTTTACATGC
Reviews

Customers who bought this product also purchased
A15076
A15076
CTS595
CTS595
A417
A417
S2679
S2679
A10033
A10033
Y4252
Y4252
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies