Top » Catalog » SNPs » A10106

$19.00

A10106
[A10106]

A10106
hg38 Position: ChrY:17285832..17285832
Ancestral: C
Derived: T
Reference: Douglas Fisher (2016)
ISOGG Haplogroup: R1b
Comments: Below Z18 > Z372 > S5970
Forward Primer: A10106_F GAGAACATTGTAAAGAGCCTGACAC
Reverse Primer: A10106_R AGTCTGCATGGTGTCACATTTC
Reviews

Customers who bought this product also purchased
A10109
A10109
A10108
A10108
Wish a SNP
Wish a SNP
BY17966
BY17966
BY17956
BY17956
S7019
S7019
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies