Top » Catalog » SNPs » A10107

$18.00

A10107
[A10107]

A10107
HG19 Position: ChrY:17166777..17166777
Ancestral: A
Derived: T
Reference: Douglas Fisher (2016)
ISOGG Haplogroup: R1b
Comments: Below Z18 > Z372 > S5970
Forward Primer: A10107_F GTGCAGTTTTGTTGCATGG
Reverse Primer: A10107_R TCTTCACAGCAGCGAAGATG
Reviews

Customers who bought this product also purchased
A10106
A10106
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies