Top » Catalog » SNPs » A10107

$18.00

A10107
[A10107]

A10107
HG19 Position: ChrY:15054897..15054897
Ancestral: A
Derived: T
Reference: Douglas Fisher (2016)
ISOGG Haplogroup: R1b
Comments: Below Z18 > Z372 > S5970
Forward Primer: A10107_F GTGCAGTTTTGTTGCATGG
Reverse Primer: A10107_R TCTTCACAGCAGCGAAGATG
Reviews

Customers who bought this product also purchased
A10108
A10108
Wish a SNP
Wish a SNP
BY17966
BY17966
BY17956
BY17956
S7019
S7019
A10109
A10109
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11143
1 x A1011
1 x A10036
1 x A10534
1 x A10235
1 x A11210
$108.00
Haplogroup Info
Other products
Currencies