Top » Catalog » SNPs » A10109

$18.00

A10109
[A10109]

A10109
HG19 Position: ChrY:15007318..15007318
Ancestral: A
Derived: G
Reference: Douglas Fisher (2016)
ISOGG Haplogroup: R1b
Comments: Below Z18 > Z372 > S5970
Forward Primer: A10109_F GGGAGTTACTGCGGGAAAAC
Reverse Primer: A10109_R ACCCAAGGGAGGTGAGTTTC
Reviews

Customers who bought this product also purchased
A10108
A10108
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies