Top » Catalog » SNPs » A10110

$18.00

A10110
[A10110]

A10110
HG19 Position: ChrY:2913202..2913202
Ancestral: G
Derived: A
Reference: Zdenko Markovic (2016)
ISOGG Haplogroup: I2
Comments: Downstream of L1294
Forward Primer: A10110_F CCACATTTGAGTCCATGATTTAAG
Reverse Primer: A10110_R GCCAGACCCATCATTAGTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies