Top » Catalog » SNPs » A10111

$18.00

A10111
[A10111]

A10111
HG19 Position: ChrY:21225818..21225818
Ancestral: A
Derived: C
Reference: Zdenko Markovic (2016)
ISOGG Haplogroup: I2
Comments: Downstream of L1294
Forward Primer: A10111_F GAGCGATGGCTACCACCTAC
Reverse Primer: A10111_R TCCCCCAGATCCATACAAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies