Top » Catalog » SNPs » A10112

$17.50

A10112
[A10112]

A10112
HG19 Position: ChrY:14043980..14043980
Ancestral: T
Derived: C
Reference: Zdenko Markovic (2016)
ISOGG Haplogroup: I2
Comments: Downstream of L1294
Forward Primer: A10112_F TGATGCCAGCTAGGGTCTTG
Reverse Primer: A10112_R CTACTACTGGCTCAATGGCTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies