Top » Catalog » SNPs » A10113

$18.00

A10113
[A10113]

A10113
HG19 Position: ChrY:8133864..8133864
Ancestral: A
Derived: G
Reference: Aaron Pierce (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of CTS9686
Forward Primer: A10113_F TCCTTATAGGGGAACATTTCCAG
Reverse Primer: A10113_R TGCAGTCCAGAATCTCAGCTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11017
1 x A11662
1 x A11426
1 x A11472
$72.00
Haplogroup Info
Other products
Currencies