Top » Catalog » SNPs » A10115

$17.50

A10115
[A10115]

A10115
HG19 Position: ChrY:14148267..14148267
Ancestral: T
Derived: C
Reference: Aaron Pierce (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of CTS9686
Forward Primer: A10115_F GCTGAAAGAAAATTCTCATGACG
Reverse Primer: A10115_R TAATGTCTTTCTAACTTGTTTGGTGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies