Top » Catalog » SNPs » A10116

$18.00

A10116
[A10116]

A10116
HG19 Position: ChrY:12517080..12517080
Ancestral: G
Derived: T
Reference: Aaron Pierce (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of CTS9686
Forward Primer: A10116_F CCAGAAACCACTCATTTTACCAC
Reverse Primer: A10116_R TCACAGGATTGGAAGGATGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10299
1 x A10131
1 x A11106
$54.00
Haplogroup Info
Other products
Currencies