Top » Catalog » SNPs » A10118

$18.00

A10118
[A10118]

A10118
HG19 Position: ChrY:19212208..19212208
Ancestral: A
Derived: C
Reference: Aaron Pierce (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of CTS9686
Forward Primer: A10118_F GAAAATCCCCAAGCTGAAGAAG
Reverse Primer: A10118_R GATTATCAATACCCTCCCTGATG
Reviews

Customers who bought this product also purchased
A17283
A17283
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies