Top » Catalog » SNPs » A10118

$18.00

A10118
[A10118]

A10118
hg38 Position: ChrY:17100328..17100328
Ancestral: A
Derived: C
Reference: Aaron Pierce (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of Z251 > CTS9686 > A237
Forward Primer: A10118_F GAAAATCCCCAAGCTGAAGAAG
Reverse Primer: A10118_R GATTATCAATACCCTCCCTGATG
Reviews

Customers who bought this product also purchased
A17283
A17283
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies