Top » Catalog » SNPs » A10122

$18.00

A10122
[A10122]

A10122
HG19 Position: ChrY:2713485..2713485
Ancestral: T
Derived: A
Reference: Connie McKenzie (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of U106
Forward Primer: A10122_F AGTCATGGAGGGCGTAAATG
Reverse Primer: A10122_R GTTTCTTTTGCCTGCACAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies