Top » Catalog » SNPs » A10125

$18.00

A10125
[A10125]

A10125
HG19 Position: ChrY:8144058..8144058
Ancestral: A
Derived: G
Reference: Connie McKenzie (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of U106
Forward Primer: A10125_F GACACGCATTAGTGCTACCAATAG
Reverse Primer: A10125_R TAGCTCACTGCAACCTCTGTCTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10680
1 x A10253
1 x A10293
1 x A10627
1 x A11221
1 x A1074
$108.00
Haplogroup Info
Other products
Currencies