Top » Catalog » SNPs » A10125

$18.00

A10125
[A10125]

A10125
HG19 Position: ChrY:8144058..8144058
Ancestral: A
Derived: G
Reference: Connie McKenzie (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of U106
Forward Primer: A10125_F GACACGCATTAGTGCTACCAATAG
Reverse Primer: A10125_R TAGCTCACTGCAACCTCTGTCTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10520
1 x A1028
1 x A10498
1 x A10022
1 x A10734
1 x A101
1 x A11653
1 x A11008
1 x A11550
1 x A10964
$180.00
Haplogroup Info
Other products
Currencies