Top » Catalog » SNPs » A10132

$18.00

A10132
[A10132]

A10132
hg38 Position: ChrY:13817123..13817123
Ancestral: T
Derived: G
Reference: Connie McKenzie (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of U106
Forward Primer: A10132_F CTCCAGAGGCCTAAGGATTTC
Reverse Primer: A10132_R CTTGCTTGACTGACGGAATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies