Top » Catalog » SNPs » A10133

$18.00

A10133
[A10133]

A10133
HG19 Position: ChrY:13885284..13885284
Ancestral: A
Derived: G
Reference: Connie McKenzie (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of U106
Forward Primer: A10133_F CTGAGGGAGTCCTCAGATGG
Reverse Primer: A10133_R ATTTGGGTAAATTCCATATCTCTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10071
1 x A11622
1 x A10580
1 x A10318
1 x A1
1 x A10129
1 x A10840
1 x A11628
1 x A10441
$162.00
Haplogroup Info
Other products
Currencies