Top » Catalog » SNPs » A10136

$18.00

A10136
[A10136]

A10136
hg38 Position: ChrY:14107259..14107259
Ancestral: G
Derived: A
Reference: Connie McKenzie (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of U106
Forward Primer: A10136_F CATGGTCTTGCTGTGTTTCC
Reverse Primer: A10136_R GAAAAGGGCGGTGTGTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies