Top » Catalog » SNPs » A10139

$18.00

A10139
[A10139]

A10139
HG19 Position: ChrY:14649841..14649841
Ancestral: G
Derived: A
Reference: Connie McKenzie (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of U106
Forward Primer: A10139_F CAATGTGGATGGTAGATCAGTGG
Reverse Primer: A10139_R ATGGGATAGTCTGAGGCACAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11379
1 x A10741
1 x A10887
1 x A11002
1 x A11304
1 x A11618
1 x A10135
$126.00
Haplogroup Info
Other products
Currencies