Top » Catalog » SNPs » A10140

$18.00

A10140
[A10140]

A10140
HG19 Position: ChrY:15374968..15374968
Ancestral: C
Derived: A
Reference: Connie McKenzie (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of U106
Forward Primer: A10140_F GGTGTGACCACACACAATCC
Reverse Primer: A10140_R TGCATGTGGTGCATTTCTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10001
1 x A10225
1 x A10097
1 x A10025
1 x A11385
1 x A10107
$108.00
Haplogroup Info
Other products
Currencies