Top » Catalog » SNPs » A10142

$18.00

A10142
[A10142]

A10142
HG19 Position: ChrY:15658877..15658877
Ancestral: C
Derived: T
Reference: Connie McKenzie (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of U106
Forward Primer: A10142_F GGCATGATCACAGGTCACAG
Reverse Primer: A10142_R TGACTTCTCACTTGTCGTTTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11611
1 x A11440
1 x A11200
1 x A10947
$72.00
Haplogroup Info
Other products
Currencies