Top » Catalog » SNPs » A10145

$18.00

A10145
[A10145]

A10145
HG19 Position: ChrY:18764200..18764200
Ancestral: G
Derived: T
Reference: Connie McKenzie (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of U106
Forward Primer: A10145_F GCCTAGGCTGGTCTCAAACTC
Reverse Primer: A10145_R CAAAAACCTGTTAAATGCTCACG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies