Top » Catalog » SNPs » A10148

$18.00

A10148
[A10148]

A10148
hg38 Position: ChrY:18941222..18941222
Ancestral: C
Derived: T
Reference: Connie McKenzie (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of U106
Forward Primer: A10148_F GATTTCAGAATTTTCAGGTGTAAGTG
Reverse Primer: A10148_R AGGACATGGTGGCTCACAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies