Top » Catalog » SNPs » A10152

$18.00

A10152
[A10152]

A10152
hg38 Position: ChrY:20656072..20656072
Ancestral: A
Derived: T
Reference: Connie McKenzie (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of U106
Forward Primer: A10152_F CAGGAGAAGGAAGGATCGTG
Reverse Primer: A10152_R CTGAATCAGGGAAGCACTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies