Top » Catalog » SNPs » A10153

$18.00

A10153
[A10153]

A10153
HG19 Position: ChrY:20762995..20762995
Ancestral: G
Derived: A
Reference: Connie McKenzie (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of U106
Forward Primer: A10153_F AGGCATAAACCACCACACG
Reverse Primer: A10153_R CCACCACTCTCCACTCTGAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10523
$18.00
Haplogroup Info
Other products
Currencies