Top » Catalog » SNPs » A10155

$18.00

A10155
[A10155]

A10155
hg38 Position: ChrY:21338278..21338278
Ancestral: G
Derived: C
Reference: Connie McKenzie (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of U106
Forward Primer: A10155_F ATGCCTTTCTATGTGCCAATC
Reverse Primer: A10155_R TGATACGAACAAAGGACAGTCG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies