Top » Catalog » SNPs » A10159

$18.00

A10159
[A10159]

A10159
hg38 Position: ChrY:16449352..16449352
Ancestral: A
Derived: C
Reference: Roger Woods (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream of A766 and A764
Forward Primer: A10159_F AAAAAATAAGGCAAATAGACATTTGG
Reverse Primer: A10159_R CAGTGAGAGGTGATTGGATCAC
Reviews

Customers who bought this product also purchased
A9474
A9474
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies