Top » Catalog » SNPs » A10161

$18.00

A10161
[A10161]

A10161
HG19 Position: ChrY:21839583..21839583
Ancestral: C
Derived: T
Reference: Douglas Phelps (2016)
ISOGG Haplogroup: E
Comments: .
Forward Primer: A10161_F AGCCATTTGACACACGACTG
Reverse Primer: A10161_R GGTTTGGCCTAGTGTTGAGC
Reviews

Customers who bought this product also purchased
A6109
A6109
YFS563949
YFS563949
A10160
A10160
A6108
A6108
YFS563926
YFS563926
YFS523972
YFS523972
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies