Top » Catalog » SNPs » A10161

$18.00

A10161
[A10161]

A10161
HG19 Position: ChrY:19677697..19677697
Ancestral: C
Derived: T
Reference: Douglas Phelps (2016)
ISOGG Haplogroup: E
Comments: .
Forward Primer: A10161_F AGCCATTTGACACACGACTG
Reverse Primer: A10161_R GGTTTGGCCTAGTGTTGAGC
Reviews

Customers who bought this product also purchased
YFS523985
YFS523985
A10164
A10164
A6111
A6111
E1a1-Z31503 Phelps Panel
E1a1-Z31503 Phelps Panel
A10163
A10163
A6110
A6110
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies