Top » Catalog » SNPs » A10162

$18.00

A10162
[A10162]

A10162
HG19 Position: ChrY:12962851..12962851
Ancestral: T
Derived: A
Reference: Douglas Phelps (2016)
ISOGG Haplogroup: E1a1a2
Comments: Below Y17371
Forward Primer: A10162_F TTGCTTTGGCTAGTCAGTGTC
Reverse Primer: A10162_R GATGGTAGGGTCGACTGAGC
Reviews

Customers who bought this product also purchased
BY4136
BY4136
A6108
A6108
YFS563926
YFS563926
E1a1-Z31503 Phelps Panel
E1a1-Z31503 Phelps Panel
A6107
A6107
A6112
A6112
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies