Top » Catalog » SNPs » A10162

$18.00

A10162
[A10162]

A10162
hg38 Position: ChrY:12962851..12962851
Ancestral: T
Derived: A
Reference: Douglas Phelps (2016)
ISOGG Haplogroup: E1a1a2
Comments: Below Y17371
Forward Primer: A10162_F TTGCTTTGGCTAGTCAGTGTC
Reverse Primer: A10162_R GATGGTAGGGTCGACTGAGC
Reviews

Customers who bought this product also purchased
BY4136
BY4136
YFS523972
YFS523972
A6109
A6109
YFS563949
YFS563949
YFS523985
YFS523985
A6108
A6108
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies