Top » Catalog » SNPs » A10162

$18.00

A10162
[A10162]

A10162
hg38 Position: ChrY:12962851..12962851
Ancestral: T
Derived: A
Reference: Douglas Phelps (2016)
ISOGG Haplogroup: E1a1a2
Comments: Below Y17371
Forward Primer: A10162_F TTGCTTTGGCTAGTCAGTGTC
Reverse Primer: A10162_R GATGGTAGGGTCGACTGAGC
Reviews

Customers who bought this product also purchased
BY4136
BY4136
A6107
A6107
A6112
A6112
A10161
A10161
A6111
A6111
A10160
A10160
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies