Top » Catalog » SNPs » A10163

$18.00

A10163
[A10163]

A10163
HG19 Position: ChrY:15730271..15730271
Ancestral: G
Derived: T
Reference: Douglas Phelps (2016)
ISOGG Haplogroup: E
Comments: .
Forward Primer: A10163_F CCAAATGAACCTTCCTTCTCA
Reverse Primer: A10163_R CCATTCTGTAGGTTGTCTGTTCAC
Reviews

Customers who bought this product also purchased
A6109
A6109
YFS563949
YFS563949
YFS523985
YFS523985
A6108
A6108
YFS563926
YFS563926
E1a1-Z31503 Phelps Panel
E1a1-Z31503 Phelps Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies