Top » Catalog » SNPs » A10163

$18.00

A10163
[A10163]

A10163
HG19 Position: ChrY:13618391..13618391
Ancestral: G
Derived: T
Reference: Douglas Phelps (2016)
ISOGG Haplogroup: E
Comments: .
Forward Primer: A10163_F CCAAATGAACCTTCCTTCTCA
Reverse Primer: A10163_R CCATTCTGTAGGTTGTCTGTTCAC
Reviews

Customers who bought this product also purchased
YFS523972
YFS523972
A6109
A6109
YFS563949
YFS563949
YFS523985
YFS523985
A6108
A6108
YFS563926
YFS563926
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies