Top » Catalog » SNPs » A10164

$18.00

A10164
[A10164]

A10164
hg38 Position: ChrY:18910038..18910038
Ancestral: G
Derived: T
Reference: Douglas Phelps (2016)
ISOGG Haplogroup: E
Comments: .
Forward Primer: A10164_F GCGTATTTCGGCTCTTTTTG
Reverse Primer: A10164_R CTCAAGTCCCAAAATCAGTGTG
Reviews

Customers who bought this product also purchased
A6108
A6108
YFS563926
YFS563926
E1a1-Z31503 Phelps Panel
E1a1-Z31503 Phelps Panel
A6107
A6107
A6112
A6112
A10161
A10161
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies