Top » Catalog » SNPs » A10164

$18.00

A10164
[A10164]

A10164
HG19 Position: ChrY:21071924..21071924
Ancestral: G
Derived: T
Reference: Douglas Phelps (2016)
ISOGG Haplogroup: E
Comments: .
Forward Primer: A10164_F GCGTATTTCGGCTCTTTTTG
Reverse Primer: A10164_R CTCAAGTCCCAAAATCAGTGTG
Reviews

Customers who bought this product also purchased
A10161
A10161
A6111
A6111
A10160
A10160
A6110
A6110
YFS563951
YFS563951
YFS523972
YFS523972
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies