Top » Catalog » SNPs » A10000

$17.50

A10000
[A10000]

A10000
HG19 Position: ChrY:22664548..22664548
Ancestral: T
Derived: C
Reference: William Hartley (2016)
ISOGG Haplogroup: I1
Comments: Downstream I-Z59+ Y2170+ Y3643+
Forward Primer: A10000_F TCCACTGTTTCTGGGCCTAC
Reverse Primer: A10000_R CCATCCCTGAATCACCAAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies