Top » Catalog » SNPs » A10001

$18.00

A10001
[A10001]

A10001
HG19 Position: ChrY:21147741..21147741
Ancestral: G
Derived: A
Reference: William Hartley (2016)
ISOGG Haplogroup: I1
Comments: Downstream I-Z59+ Y2170+ Y3643+
Forward Primer: A10001_F TCCACCGTCTATCCCAAAAG
Reverse Primer: A10001_R GTCAGTAAATGACAAAATTTCCAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies