Top » Catalog » SNPs » A10218

$18.00

A10218
[A10218]

A10218
HG19 Position: ChrY:15307686..15307686
Ancestral: G
Derived: A
Reference: David R Moore (2015)
ISOGG Haplogroup: R1b
Comments: Downstream of L1402
Forward Primer: A10218_F AACCGACTTTCCTTCCTTCC
Reverse Primer: A10218_R TGGTTCTTTGGCAGCTTTATG
Reviews

Customers who bought this product also purchased
A10219
A10219
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies