Top » Catalog » SNPs » A10219

$18.00

A10219
[A10219]

A10219
hg38 Position: ChrY:16597625..16597625
Ancestral: T
Derived: G
Reference: David R Moore (2015)
ISOGG Haplogroup: R1b
Comments: Downstream of L1402
Forward Primer: A10219_F CGAACCCATCAAATAGTATCCTTC
Reverse Primer: A10219_R CTTGAAGCCTGGAGTTGGAG
Reviews

Customers who bought this product also purchased
A10218
A10218
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies